Human Cadherin-6/CDH6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC000019.2

RefSeq ORF Size

1992bp

Gene Synonym

CDH6, KCAD

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cadherin 6, type 2, K-cadherin (fetal kidney) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

References

Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.

Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.

Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.

Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.

Catalog Number:MGB039-CF