Mouse C4.4A/LYPD3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA996-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1092bp
Gene Synonym
C4.4a, 2310061G07Rik, Lypd3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Ly6/Plaur domain containing 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ly6 / PLAUR domain-containing protein 3, also known as GPI-anchored metastasis-associated protein C4.4A homolog, Matrigel-induced gene C4 protein, MIG-C4 and LYPD3, is a cell membrane protein which contains two UPAR/Ly6 domains. Human LYPD3 contains two UPAR/Ly6 domains. LYPD3 is expressed in placenta, skin and urothelium. It is found in suprabasal keratinocytes of chronic wounds. Weak expression of LYPD3 is found in esophagus and peripheral blood mononuclear cells. It is found in the majority of primary and metastatic transitional cell carcinomas (TCCs) and as well in breast cancer tissues, but not in adjacent normal tissues. High expression of LYPD3 is found in the tumor component of some noninvasive superficial lesions and in invasive and metastatic urothelial cancers. LYPD3 is up-regulated in migrating keratinocytes during epithelisation of incisional skin wounds. LYPD3 supports cell migration. It may be involved in urothelial cell-matrix interactions. It may also be involved in tumor progression
References
  • Smith B.A., et al., 2001, Cancer Res. 61:1678-85.
  • Wuerfel J., et al., 2001, Gene 262:35-41.
  • Clark H.F., et al., 2003, Genome Res. 13:2265-70.
  • Fletcher G.C., et al., 2003, Br. J. Cancer 88:579-85.
  • Hansen L.V., et al., 2004, Biochem. Eng. J. 380:845-57.
  • TOP