Mouse C4.4A/LYPD3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_133743.1

RefSeq ORF Size

1092bp

Gene Synonym

C4.4a, 2310061G07Rik, Lypd3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Ly6/Plaur domain containing 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ly6 / PLAUR domain-containing protein 3, also known as GPI-anchored metastasis-associated protein C4.4A homolog, Matrigel-induced gene C4 protein, MIG-C4 and LYPD3, is a cell membrane protein which contains two UPAR/Ly6 domains. Human LYPD3 contains two UPAR/Ly6 domains. LYPD3 is expressed in placenta, skin and urothelium. It is found in suprabasal keratinocytes of chronic wounds. Weak expression of LYPD3 is found in esophagus and peripheral blood mononuclear cells. It is found in the majority of primary and metastatic transitional cell carcinomas (TCCs) and as well in breast cancer tissues, but not in adjacent normal tissues. High expression of LYPD3 is found in the tumor component of some noninvasive superficial lesions and in invasive and metastatic urothelial cancers. LYPD3 is up-regulated in migrating keratinocytes during epithelisation of incisional skin wounds. LYPD3 supports cell migration. It may be involved in urothelial cell-matrix interactions. It may also be involved in tumor progression

References

Smith B.A., et al., 2001, Cancer Res. 61:1678-85.

Wuerfel J., et al., 2001, Gene 262:35-41.

Clark H.F., et al., 2003, Genome Res. 13:2265-70.

Fletcher G.C., et al., 2003, Br. J. Cancer 88:579-85.

Hansen L.V., et al., 2004, Biochem. Eng. J. 380:845-57.

Catalog Number:MGA996-CY