Rhesus Betacellulin / BTC Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGA802-NY

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
537bp
Gene Synonym
BTC
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus betacellulin Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Betacellulin(BTC) is a member of the epidermal growth factor (EGF) family. These soluble proteins are ligands for one or more of the four receptor tyrosine kinases encoded by the ErbB gene family (ErbB-1/epidermal growth factor receptor (EGFR), neu/ErbB-2/HER2, ErbB-3/HER3 and ErbB-4/HER4). Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. This protein is a ligand for the EGF receptor. BTC is a polymer of about 62-111 amino acid residues. Secondary Structure: 6% helical (1 helices; 3 residues)36% beta sheet (5 strands; 18 residues). BTC was originally identified as a growth-promoting factor in mouse pancreatic β-cell carcinoma cell line and has since been identified in humans. It plays a role in the growth and development of the neonate and/or mammary gland function. Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.
References
  • Shing Y, et al. (1993) Betacellulin: a mitogen from pancreatic beta cell tumors. Science . 259(5101): 1604-7.
  • Riese DJ, et al. (1996) Betacellulin activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta. Oncogene. 12(2): 345-53.
  • Bastian SE, et al. (2001) Measurement of betacellulin levels in bovine serum, colostrum and milk. J Endocrinol . 168: 203-12.
  • TOP