Rhesus Betacellulin / BTC Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001101880.2

RefSeq ORF Size

537bp

Gene Synonym

BTC

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus betacellulin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Betacellulin(BTC) is a member of the epidermal growth factor (EGF) family. These soluble proteins are ligands for one or more of the four receptor tyrosine kinases encoded by the ErbB gene family (ErbB-1/epidermal growth factor receptor (EGFR), neu/ErbB-2/HER2, ErbB-3/HER3 and ErbB-4/HER4). Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. This protein is a ligand for the EGF receptor. BTC is a polymer of about 62-111 amino acid residues. Secondary Structure: 6% helical (1 helices; 3 residues)36% beta sheet (5 strands; 18 residues). BTC was originally identified as a growth-promoting factor in mouse pancreatic β-cell carcinoma cell line and has since been identified in humans. It plays a role in the growth and development of the neonate and/or mammary gland function. Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.

References

Shing Y, et al. (1993) Betacellulin: a mitogen from pancreatic beta cell tumors. Science . 259(5101): 1604-7.

Riese DJ, et al. (1996) Betacellulin activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta. Oncogene. 12(2): 345-53.

Bastian SE, et al. (2001) Measurement of betacellulin levels in bovine serum, colostrum and milk. J Endocrinol . 168: 203-12.

Catalog Number:MGA802-CO