Mouse ApoM / Apolipoprotein M Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_018816.1

RefSeq ORF Size

573bp

Gene Synonym

G3a; NG20; 1190010O19Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse apolipoprotein M Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ApoM (apolipoprotein M) is an apolipoprotein and member of the lipocalin protein family. The lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They have an eight-stranded, antiparallel, symmetrical _-barrel fold, which is in essence a beta sheet which has been rolled into a cylindrical shape. Inside this barrel is located a ligand binding site. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. Lipocalins have been associated with many biological processes, among them immune response, pheromone transport, biological prostaglandin synthesis, retinoid binding, and cancer cell interactions. Lipocalins are comparatively small in size, and are thus less complicated to study as opposed to large, bulky proteins. They can also bind to various ligands for different biological purposes. ApoM is associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. ApoM is involved in lipid transport and can bind sphingosine-1-phosphate, myristic acid, palmitic acid and stearic acid, retinol, all-trans-retinoic acid and 9-cis-retinoic acid.

References

Xu N, et al. (1999) A novel human apolipoprotein (apoM). J Biol Chem. 274(44):31286-90.

Duan J, et al. (2001) Proposed lipocalin fold for apolipoprotein M based on bioinformatics and site-directed mutagenesis. FEBS Lett. 49 (1-2):127-32.

Albertella MR, et al. (1997) Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II beta subunit (CSNK2B). Genomics. 36(2):240-51.

Catalog Number:MGA490-NY