Mouse ApoM / Apolipoprotein M Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA490-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
573bp
Gene Synonym
G3a; NG20; 1190010O19Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse apolipoprotein M Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ApoM (apolipoprotein M) is an apolipoprotein and member of the lipocalin protein family. The lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They have an eight-stranded, antiparallel, symmetrical _-barrel fold, which is in essence a beta sheet which has been rolled into a cylindrical shape. Inside this barrel is located a ligand binding site. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. Lipocalins have been associated with many biological processes, among them immune response, pheromone transport, biological prostaglandin synthesis, retinoid binding, and cancer cell interactions. Lipocalins are comparatively small in size, and are thus less complicated to study as opposed to large, bulky proteins. They can also bind to various ligands for different biological purposes. ApoM is associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. ApoM is involved in lipid transport and can bind sphingosine-1-phosphate, myristic acid, palmitic acid and stearic acid, retinol, all-trans-retinoic acid and 9-cis-retinoic acid.
References
  • Xu N, et al. (1999) A novel human apolipoprotein (apoM). J Biol Chem. 274(44):31286-90.
  • Duan J, et al. (2001) Proposed lipocalin fold for apolipoprotein M based on bioinformatics and site-directed mutagenesis. FEBS Lett. 49 (1-2):127-32.
  • Albertella MR, et al. (1997) Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II beta subunit (CSNK2B). Genomics. 36(2):240-51.
  • TOP