Mouse Amyloid beta A4 protein Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGA391-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2088bp
Gene Synonym
Adap, Cvap, Abeta, appican, betaAPP, AL024401, E030013M08Rik, App
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse amyloid beta (A4) precursor protein Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.
References
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • TOP