Mouse Amyloid beta A4 protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007471.2

RefSeq ORF Size

2088bp

Gene Synonym

Adap, Cvap, Abeta, appican, betaAPP, AL024401, E030013M08Rik, App

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse amyloid beta (A4) precursor protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

References

Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.

Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.

Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.

Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.

Catalog Number:MGA391-NF