Mouse Alpha-fetoprotein/AFP Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGA367-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1818bp
Gene Synonym
Afp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse alpha fetoprotein Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI (6kb + 1.86kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).
References
  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • TOP