Mouse Alpha-fetoprotein/AFP Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA367-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1818bp
Gene Synonym
Afp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse alpha fetoprotein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
KpnI + XbaI (6kb + 1.86kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).
References
  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • TOP