Mouse AKT3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGA307-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1440bp
Gene Synonym
AI851531, D930002M15Rik, Akt3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse thymoma viral proto-oncogene 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.
References
  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • TOP