Mouse AKT3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011785.3

RefSeq ORF Size

1440bp

Gene Synonym

AI851531, D930002M15Rik, Akt3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse thymoma viral proto-oncogene 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

References

Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.

Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.

Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.

Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.

Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.

Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.

Catalog Number:MGA307-CY