Mouse Adiponectin/Acrp30/ADIPOQ Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGA215-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744bp
Gene Synonym
APN, Acdc, apM1, 30kDa, GBP28, adipo, Acrp30, Adipoq
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse adiponectin, C1Q and collagen domain containing Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI (6kb + 0.79kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Unlike other adipocytokines produced by adipose tissue, adiponectin appears to have anti-inflammatory, anti-diabetic, and anti-atherogenic properties. Several clinical studies demonstrate the inverse relationship between plasma adiponectin levels and several inflammatory markers including C-reactive protein. Adiponectin attenuates inflammatory responses to multiple stimuli by modulating signaling pathways in a variety of cell types. The anti-inflammatory properties of adiponectin may be a major component of its beneficial effects on cardiovascular and metabolic disorders including atherosclerosis and insulin resistance. Additionally, it is important factor in chronic liver diseases and chronic kidney diseases. Some cancer cell types express adiponectin receptors. Thus Adiponectin may act on tumour cells directly by binding and activating adiponectin receptors and downstream signalling pathways.
References
  • Cui J, et al. (2011) The role of adiponectin in metabolic and vascular disease: a review. Clin Nephrol. 75(1): 26-33.
  • Michalakis KG, et al. (2010) The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction. Fertil Steril. 94(6): 1949-57.
  • Dez JJ, et al.. (2010) The role of the novel adipocyte-derived protein adiponectin in human disease: an update. Mini Rev Med Chem. 10(9): 856-69.
  • Ouchi N, et al. (2007) Adiponectin as an anti-inflammatory factor. Clin Chim Acta. 380(1-2): 24-30.
  • Barb D, et al. (2006) Adiponectin: a link between obesity and cancer. Expert Opin Investig Drugs. 15(8): 917-31.
  • TOP