Mouse Adiponectin/Acrp30/ADIPOQ Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGA215-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744bp
Gene Synonym
APN, Acdc, apM1, 30kDa, GBP28, adipo, Acrp30, Adipoq
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse adiponectin, C1Q and collagen domain containing Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
KpnI + XbaI (6kb + 0.79kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Unlike other adipocytokines produced by adipose tissue, adiponectin appears to have anti-inflammatory, anti-diabetic, and anti-atherogenic properties. Several clinical studies demonstrate the inverse relationship between plasma adiponectin levels and several inflammatory markers including C-reactive protein. Adiponectin attenuates inflammatory responses to multiple stimuli by modulating signaling pathways in a variety of cell types. The anti-inflammatory properties of adiponectin may be a major component of its beneficial effects on cardiovascular and metabolic disorders including atherosclerosis and insulin resistance. Additionally, it is important factor in chronic liver diseases and chronic kidney diseases. Some cancer cell types express adiponectin receptors. Thus Adiponectin may act on tumour cells directly by binding and activating adiponectin receptors and downstream signalling pathways.
References
  • Cui J, et al. (2011) The role of adiponectin in metabolic and vascular disease: a review. Clin Nephrol. 75(1): 26-33.
  • Michalakis KG, et al. (2010) The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction. Fertil Steril. 94(6): 1949-57.
  • Dez JJ, et al.. (2010) The role of the novel adipocyte-derived protein adiponectin in human disease: an update. Mini Rev Med Chem. 10(9): 856-69.
  • Ouchi N, et al. (2007) Adiponectin as an anti-inflammatory factor. Clin Chim Acta. 380(1-2): 24-30.
  • Barb D, et al. (2006) Adiponectin: a link between obesity and cancer. Expert Opin Investig Drugs. 15(8): 917-31.
  • TOP