Human YKL-39/CHI3L2 Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGI502-UT

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1173bp
Gene Synonym
YKL39, YKL-39, CHI3L2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chitinase 3-like 2 Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chondrocyte protein 39 (YKL-39), also known as Chitinase 3-like 2 (CHI3L2), is a secretory protein of articular chondrocytes belonging to the glycosyl hydrolase 18 family. It highest expression is in chondrocytes, followed by synoviocytes, lung and heart. YKL-39/CHI3L2 is not detected in spleen, pancreas, and liver. YKL-39/CHI3L2 may also be expressed in developing brain and placenta. YKL-39/CHI3L2, a cartilage-related protein, is found to induce arthritis accompanied by pathologic changes in bone and cartilage. A better understanding of the immune response against cartilage-related components including YKL-39 may help to elucidate the pathological processes of arthritic disorders. Up regulation of YKL-39/CHI3L2 in osteoarthritic cartilage suggests that YKL-39/CHI3L2 may be a more accurate marker of chondrocyte activation than YKL-40, although it has yet to be established as a suitable marker in synovial fluid and serum. The decreased expression of YKL-40 by osteoarthritic chondrocytes is surprising as increased levels have been reported in rheumatoid and osteoarthritic synovial fluid, where it may derive from activated synovial cells or osteophytic tissue or by increased matrix destruction in the osteoarthritic joint. YKL-39 and YKL-40 are potentially interesting marker molecules for arthritic joint disease because they are abundantly expressed by both normal and osteoarthritic chondrocytes.
References
  • Sakata M, et al. (2002) YKL-39, a human cartilage-related protein, induces arthritis in mice. Clin Exp Rheumatol. 20(3): 343-50.
  • Areshkov PA, et al. (2010) Chitinase 3-like protein 2 (CHI3L2, YKL-39) activates phosphorylation of extracellular signal-regulated kinases ERK1/ERK2 in human embryonic kidney (HEK293) and human glioblastoma (U87 MG) cells. Tsitol Genet. 44(1): 3-9.
  • Steck E, et al. (2002) Enhanced expression of the human chitinase 3-like 2 gene (YKL-39) but not chitinase 3-like 1 gene (YKL-40) in osteoarthritic cartilage. Biochem Biophys Res Commun. 299(1): 109-15.
  • TOP