Human YKL-39/CHI3L2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC011460

RefSeq ORF Size

1173bp

Gene Synonym

YKL39, YKL-39, CHI3L2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human chitinase 3-like 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chondrocyte protein 39 (YKL-39), also known as Chitinase 3-like 2 (CHI3L2), is a secretory protein of articular chondrocytes belonging to the glycosyl hydrolase 18 family. It highest expression is in chondrocytes, followed by synoviocytes, lung and heart. YKL-39/CHI3L2 is not detected in spleen, pancreas, and liver. YKL-39/CHI3L2 may also be expressed in developing brain and placenta. YKL-39/CHI3L2, a cartilage-related protein, is found to induce arthritis accompanied by pathologic changes in bone and cartilage. A better understanding of the immune response against cartilage-related components including YKL-39 may help to elucidate the pathological processes of arthritic disorders. Up regulation of YKL-39/CHI3L2 in osteoarthritic cartilage suggests that YKL-39/CHI3L2 may be a more accurate marker of chondrocyte activation than YKL-40, although it has yet to be established as a suitable marker in synovial fluid and serum. The decreased expression of YKL-40 by osteoarthritic chondrocytes is surprising as increased levels have been reported in rheumatoid and osteoarthritic synovial fluid, where it may derive from activated synovial cells or osteophytic tissue or by increased matrix destruction in the osteoarthritic joint. YKL-39 and YKL-40 are potentially interesting marker molecules for arthritic joint disease because they are abundantly expressed by both normal and osteoarthritic chondrocytes.

References

Sakata M, et al. (2002) YKL-39, a human cartilage-related protein, induces arthritis in mice. Clin Exp Rheumatol. 20(3): 343-50.

Areshkov PA, et al. (2010) Chitinase 3-like protein 2 (CHI3L2, YKL-39) activates phosphorylation of extracellular signal-regulated kinases ERK1/ERK2 in human embryonic kidney (HEK293) and human glioblastoma (U87 MG) cells. Tsitol Genet. 44(1): 3-9.

Steck E, et al. (2002) Enhanced expression of the human chitinase 3-like 2 gene (YKL-39) but not chitinase 3-like 1 gene (YKL-40) in osteoarthritic cartilage. Biochem Biophys Res Commun. 299(1): 109-15.

Catalog Number:HGI502-CM