Rat VRK1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001012194.1

RefSeq ORF Size

1245bp

Gene Synonym

Vrk1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat vaccinia related kinase 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

VRK1 is a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. Serine/threonine protein kinases are tumor suppressor that controls the activity of AMP-activated protein kinase family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. VRK1 contains 1 protein kinase domain and localizes to the nucleus. VRK1 gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. As a serine/threonine kinase, VRK1 phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Defects in VRK1 are the cause of pontocerebellar hypoplasia type 1 (PCH1), also called pontocerebellar hypoplasia with infantile spinal muscular atrophy or pontocerebellar hypoplasia with anterior horn cell disease. PCH1 is characterized by an abnormally small cerebellum and brainstem, central and peripheral motor dysfunction from birth, gliosis and anterior horn cell degeneration resembling infantile spinal muscular atrophy.

References

Sugimoto J, et al. (1999) Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus. J Hum Genet. 44 (2): 133-4.

Lopez-Borges S, et al. (2000) The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Oncogene. 19 (32): 3656-64.

Sevilla A, et al. (2004) c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Oncogene. 23 (55): 8950-8.

Catalog Number:HGI389-CY