Human VLDLR Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_003383.3

RefSeq ORF Size

2622bp

Gene Synonym

CHRMQ1, VLDLRCH, FLJ35024, VLDLR

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human very low density lipoprotein receptor Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The very low density lipoprotein receptor, known as VLDLR, is a single-pass type 1 integral membrance protein and a member of the LDL receptor family. This receptor family includes LDL receptor, LRP, megalin, VLDLR and ApoER2, and is characterized by a cluster of cysteine-rich class A repeats, epidermal growth factor (EGF)-like repeats, YWTD repeats and an O-linked sugar domain. VLDLR contains 3 EGF-like domains, 8 LDL-receptor class A domains, as well as 6 LDL-receptor class B repeats, and is abundant in heart, skeletal muscle, also ovary and kidney, but not in liver. VLDLR binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. VLDLR mediates the phosphorylation of mDab1 (mammalian disabled protein) via binding to Reelin, and induces the modulation of Tau phosphorylation. This pathway regulates the migration of neurons along the radial glial fiber network during brain development. Defects of VLDLR may be the cause of VLDLR-associated cerebellar hypoplasia (VLDLRCH), a syndrome characterized by moderate-to-profound mental retardation, delayed ambulation, and predominantly truncal ataxia.

References

Trommsdorff, M. et al., 1999. Cell. 97: 689-701.

Mikhailenko, I. et al., 1999. J. Cell Sci. 112: 3269-3281.

Sato, A. et al., 1999. Biochem. J. 341: 377-383.

Hiesberger, T. et al., 1999. Neuron 24: 481-489.

Tiebel, O. et al., 1999. Atherosclerosis 145: 239-251.

Boycott, K.M. et al., 2005, Am. J. Hum. Genet. 77 (3): 477-483.

Moheb, L.A. et al., 2008, Eur. J. Hum. Genet. 16 (2): 270-273.

Catalog Number:HGI368-NM