Human VLDLR Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGI368-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2622bp
Gene Synonym
CHRMQ1, VLDLRCH, FLJ35024, VLDLR
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human very low density lipoprotein receptor Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The very low density lipoprotein receptor, known as VLDLR, is a single-pass type 1 integral membrance protein and a member of the LDL receptor family. This receptor family includes LDL receptor, LRP, megalin, VLDLR and ApoER2, and is characterized by a cluster of cysteine-rich class A repeats, epidermal growth factor (EGF)-like repeats, YWTD repeats and an O-linked sugar domain. VLDLR contains 3 EGF-like domains, 8 LDL-receptor class A domains, as well as 6 LDL-receptor class B repeats, and is abundant in heart, skeletal muscle, also ovary and kidney, but not in liver. VLDLR binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. VLDLR mediates the phosphorylation of mDab1 (mammalian disabled protein) via binding to Reelin, and induces the modulation of Tau phosphorylation. This pathway regulates the migration of neurons along the radial glial fiber network during brain development. Defects of VLDLR may be the cause of VLDLR-associated cerebellar hypoplasia (VLDLRCH), a syndrome characterized by moderate-to-profound mental retardation, delayed ambulation, and predominantly truncal ataxia.
References
  • Trommsdorff, M. et al., 1999. Cell. 97: 689-701.
  • Mikhailenko, I. et al., 1999. J. Cell Sci. 112: 3269-3281.
  • Sato, A. et al., 1999. Biochem. J. 341: 377-383.
  • Hiesberger, T. et al., 1999. Neuron 24: 481-489.
  • Tiebel, O. et al., 1999. Atherosclerosis 145: 239-251.
  • Boycott, K.M. et al., 2005, Am. J. Hum. Genet. 77 (3): 477-483. 
  • Moheb, L.A. et al., 2008, Eur. J. Hum. Genet. 16 (2): 270-273.
  • TOP