Human UBASH3A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGI193-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1872bp
Gene Synonym
CLIP4, STS-2, TULA, TULA-1, UBASH3A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquitin associated and SH3 domain containing, A Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
UBASH3A is a member of the T-cell ubiquitin ligand (TULA) family. This family consists of two members. Both of them can negatively regulate T-cell signaling. UBASH3A can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of UBASH3A gene results in multiple transcript variants. It interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. UBASH3A promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. UBASH3A also exhibits negligigle protein tyrosine phosphatase activity at neutral pH. It may act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. It may also inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain.
References
  • Collingwood TS, et al. (2007) T-cell ubiquitin ligand affects cell death through a functional interaction with apoptosis-inducing factor, a key factor of caspase-independent apoptosis.". J. Biol. Chem. 282 (42): 30920-8.
  • Smirnova EV, et al. (2008) TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion. Virology. 372(1):10-23.
  • Wattenhofer M, et al. (2001) Isolation and characterization of the UBASH3A gene on 21q22.3 encoding a potential nuclear protein with a novel combination of domains. Hum Genet. 108(2):140-7.
  • TOP