Human UBASH3A Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC069511

RefSeq ORF Size

1872bp

Gene Synonym

CLIP4, STS-2, TULA, TULA-1, UBASH3A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ubiquitin associated and SH3 domain containing, A Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

UBASH3A is a member of the T-cell ubiquitin ligand (TULA) family. This family consists of two members. Both of them can negatively regulate T-cell signaling. UBASH3A can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of UBASH3A gene results in multiple transcript variants. It interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. UBASH3A promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. UBASH3A also exhibits negligigle protein tyrosine phosphatase activity at neutral pH. It may act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. It may also inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain.

References

Collingwood TS, et al. (2007) T-cell ubiquitin ligand affects cell death through a functional interaction with apoptosis-inducing factor, a key factor of caspase-independent apoptosis.". J. Biol. Chem. 282 (42): 30920-8.

Smirnova EV, et al. (2008) TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion. Virology. 372(1):10-23.

Wattenhofer M, et al. (2001) Isolation and characterization of the UBASH3A gene on 21q22.3 encoding a potential nuclear protein with a novel combination of domains. Hum Genet. 108(2):140-7.

Catalog Number:HGI193-CF