Human TREML2/TLT-2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_024807.2

RefSeq ORF Size

966bp

Gene Synonym

TLT2, C6orf76, FLJ13693, MGC149715, MGC149716, dJ238O23.1, TREML2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human triggering receptor expressed on myeloid cells-like 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

References

Mungall A.J. et al., 2003, Nature. 425: 805-11.

Clark HF. et al., 2003, Genome Res. 13: 2265-70.

The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.

Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.

Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.

Catalog Number:HGI026-NF