Human TREML2/TLT-2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_024807.2

RefSeq ORF Size

966bp

Gene Synonym

TLT2, C6orf76, FLJ13693, MGC149715, MGC149716, dJ238O23.1, TREML2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human triggering receptor expressed on myeloid cells-like 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

References

Mungall A.J. et al., 2003, Nature. 425: 805-11.

Clark HF. et al., 2003, Genome Res. 13: 2265-70.

The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.

Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.

Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.

Catalog Number:HGI026-CO