Rat Transferrin/TF Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGI008-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2097bp
Gene Synonym
Tfn, Trf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transferrin Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Transferrin is a glycoprotein with an approximate molecular weight of 76.5 kDa. This glycoprotein is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of Transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte / pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. Transferrins are iron binding transport proteins which bind Fe3+ ion in association with the binding of an anion, usually bicarbonate. This transferrin binds only one Fe3+ ion per protein molecule. Transports iron ions from the hemolymph into the eggs during the vitellogenic stage. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation. When a transferrin loaded with iron encounters with a transferring receptor on cell surface, transferring binds to it and, as a consequence, is transported into the cell in a visicle by receptor-mediated endocytosis. The PH is reduced by hydrogen iron pumps. The lower pH causes transferrin to release its iron ions. The receptor is then transported through the endocytic cycle back to the cell surface, ready for another round of iron uptake. Each transferrin molecule has the ability to carry two iron ions in the ferric form.
References
  • Ponka P, et al. (1998) Function and regulation of transferrin and ferritin. Semin Hematol. 35(1): 35-54.
  • Wagner E, et al. (1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci. 87(9): 3410-4.
  • Cheng Y, et al. (2004) Structure of the human transferrin receptor-transferrin complex. Cell. 116 (4): 565-76.
  • TOP