Rat Transferrin/TF Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001013110.1

RefSeq ORF Size

2097bp

Gene Synonym

Tfn, Trf

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat transferrin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Transferrin is a glycoprotein with an approximate molecular weight of 76.5 kDa. This glycoprotein is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of Transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte / pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. Transferrins are iron binding transport proteins which bind Fe3+ ion in association with the binding of an anion, usually bicarbonate. This transferrin binds only one Fe3+ ion per protein molecule. Transports iron ions from the hemolymph into the eggs during the vitellogenic stage. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation. When a transferrin loaded with iron encounters with a transferring receptor on cell surface, transferring binds to it and, as a consequence, is transported into the cell in a visicle by receptor-mediated endocytosis. The PH is reduced by hydrogen iron pumps. The lower pH causes transferrin to release its iron ions. The receptor is then transported through the endocytic cycle back to the cell surface, ready for another round of iron uptake. Each transferrin molecule has the ability to carry two iron ions in the ferric form.

References

Ponka P, et al. (1998) Function and regulation of transferrin and ferritin. Semin Hematol. 35(1): 35-54.

Wagner E, et al. (1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci. 87(9): 3410-4.

Cheng Y, et al. (2004) Structure of the human transferrin receptor-transferrin complex. Cell. 116 (4): 565-76.

Catalog Number:HGI008-CM