Rat TNFRSF21/DR6 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGH927-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1968bp
Gene Synonym
Tnfrsf21
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 21 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.
References
  • Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.
  • Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.
  • Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.
  • TOP