Rat TNFRSF21/DR6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGH927-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1968bp
Gene Synonym
Tnfrsf21
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 21 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.
References
  • Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.
  • Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.
  • Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.
  • TOP