Mouse TMED1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGH789-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684bp
Gene Synonym
St2l, Ly84l, Il1rl1l
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse transmembrane emp24 domain containing 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.
References
  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • TOP