Mouse TMED1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGH789-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684bp
Gene Synonym
St2l, Ly84l, Il1rl1l
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse transmembrane emp24 domain containing 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.
References
  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • TOP