Rat TL1A / TNFSF15 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH757-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
759bp
Gene Synonym
Tl1, Vegi, Tnfsf15
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 15 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TL1A, also known as TNFSF15, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is specifically expressed in endothelial cells. TL1A also can be detected in monocytes, placenta, lung, liver, kidney, skeletal muscle, pancreas, spleen, prostate, small intestine and colon. TL1A is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It mediates activation of NF-kappa-B. It also inhibits vascular endothelial growth and angiogenesis (in vitro). TL1A promotes activation of caspases and apoptosis. It is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor.
References
  • Jin T, et al. (2007) X-ray crystal structure of TNF ligand family member TL1A at 2.1A. Biochem Biophys Res Commun. 364(1):1-6.
  • Cassatella MA, et al. (2007) Soluble TNF-like cytokine (TL1A) production by immune complexes stimulated monocytes in rheumatoid arthritis. J Immunol. 178(11):7325-33
  • Prehn JL, et al. (2007) The T cell costimulator TL1A is induced by FcgammaR signaling in human monocytes and dendritic cells. J Immunol. 178(7):4033-8.
  • TOP