Rat TL1A / TNFSF15 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGH757-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
759bp
Gene Synonym
Tl1, Vegi, Tnfsf15
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 15 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TL1A, also known as TNFSF15, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is specifically expressed in endothelial cells. TL1A also can be detected in monocytes, placenta, lung, liver, kidney, skeletal muscle, pancreas, spleen, prostate, small intestine and colon. TL1A is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It mediates activation of NF-kappa-B. It also inhibits vascular endothelial growth and angiogenesis (in vitro). TL1A promotes activation of caspases and apoptosis. It is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor.
References
  • Jin T, et al. (2007) X-ray crystal structure of TNF ligand family member TL1A at 2.1A. Biochem Biophys Res Commun. 364(1):1-6.
  • Cassatella MA, et al. (2007) Soluble TNF-like cytokine (TL1A) production by immune complexes stimulated monocytes in rheumatoid arthritis. J Immunol. 178(11):7325-33
  • Prehn JL, et al. (2007) The T cell costimulator TL1A is induced by FcgammaR signaling in human monocytes and dendritic cells. J Immunol. 178(7):4033-8.
  • TOP