Human Thyroid peroxidase / TPO Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_000547.5

RefSeq ORF Size

2841 bp

Gene Synonym

MSA,TDH2A,TPX

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human thyroid peroxidase Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

KpnI + XbaI(6kb+2.84kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Thyroid peroxidase is a membrane-bound glycoprotein which belongs to the peroxidase family, XPO subfamily. It contains 1 EGF-like domain and 1 Sushi (CCP/SCR) domain. Thyroid Peroxidase represents one of the main autoantigenic targets in autoimmune thyroid disease of humans. It used to be taken as the formerly so-called `microsomal antigen` several years ago. As an integral membrane glycoprotein it is restricted to the apical plasma membrane of the follicular epithelial cells and comprises two identical subunits of approx 100 kDa molecular weight. Thyroid peroxidase is an enzyme expressed abundantly in the thyroid that liberates iodine for addition onto tyrosine residues on thyroglobulin for the production of thyroxine or triiodothyronine, thyroid hormones. Thyroid peroxidase plays a key role in the thyroid hormone biosynthesis by catalysing both the iodination of tyrosyl residues and the coupling of iodotyrosyl residues in thyroglobulin to form precursors of the thyroid hormones T4 and T3.

References

McLachlan SM, et al. (2000) Autoimmune response to the thyroid in humans: thyroid peroxidase--the common autoantigenic denominator. Int Rev Immunol. 19(6):587-618.

Nagasaka A, et al. (1976) Effect of antithyroid agents 6-propyl-2-thiouracil and 1-mehtyl-2-mercaptoimidazole on human thyroid iodine peroxidase. J Clin Endocrinol Metab. 43(1): 152-8.

Kimura S, et al. (1987) Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs. Proc Natl Acad. 84(16):5555-9.

Ruf J, et al. (2006) Structural and functional aspects of thyroid peroxidase. Arch Biochem Biophys. 445 (2):269-77.

Catalog Number:HGH723-CO