Human Thyroid peroxidase / TPO Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGH723-CG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2841 bp
Gene Synonym
MSA,TDH2A,TPX
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human thyroid peroxidase Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
KpnI + XbaI(6kb+2.84kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Thyroid peroxidase is a membrane-bound glycoprotein which belongs to the peroxidase family, XPO subfamily. It contains 1 EGF-like domain and 1 Sushi (CCP/SCR) domain. Thyroid Peroxidase represents one of the main autoantigenic targets in autoimmune thyroid disease of humans. It used to be taken as the formerly so-called `microsomal antigen` several years ago. As an integral membrane glycoprotein it is restricted to the apical plasma membrane of the follicular epithelial cells and comprises two identical subunits of approx 100 kDa molecular weight. Thyroid peroxidase is an enzyme expressed abundantly in the thyroid that liberates iodine for addition onto tyrosine residues on thyroglobulin for the production of thyroxine or triiodothyronine, thyroid hormones. Thyroid peroxidase plays a key role in the thyroid hormone biosynthesis by catalysing both the iodination of tyrosyl residues and the coupling of iodotyrosyl residues in thyroglobulin to form precursors of the thyroid hormones T4 and T3.
References
  • McLachlan SM, et al. (2000) Autoimmune response to the thyroid in humans: thyroid peroxidase--the common autoantigenic denominator. Int Rev Immunol. 19(6):587-618.
  • Nagasaka A, et al. (1976) Effect of antithyroid agents 6-propyl-2-thiouracil and 1-mehtyl-2-mercaptoimidazole on human thyroid iodine peroxidase. J Clin Endocrinol Metab. 43(1): 152-8.
  • Kimura S, et al. (1987) Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs. Proc Natl Acad. 84(16):5555-9.
  • Ruf J, et al. (2006) Structural and functional aspects of thyroid peroxidase. Arch Biochem Biophys. 445 (2):269-77.
  • TOP