Human TFAP2C / AP2-GAMMA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_003222.3

RefSeq ORF Size

1353bp

Gene Synonym

ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).

References

Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.

Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.

Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.

Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.

Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.

Catalog Number:HGH668-NM