Human TFAP2C / AP2-GAMMA Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGH668-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1353bp
Gene Synonym
ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).
References
  • Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.
  • Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.
  • Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.
  • Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.
  • Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.
  • TOP