Human Testatin Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGH660-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444bp
Gene Synonym
bA218C14.1, CST9L
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cystatin 9-like Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are strikingly restricted to reproductive tissue. Cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. There are typically about 115 amino acids in this family. They are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds, may be glycosylated and/or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Testatin shows homology to family 2 cystatins, a group of broadly expressed small secretory proteins that are inhibitors of cysteine proteases in vitro but whose in vivo functions are unclear. It is expressed in germ cells and somatic cells in reproductive tissues. Testatin is considered a strong candidate for involvement in early testis development. Testatin expression is maintained in the adult Sertoli cell, and it can also be found in a small population of germ cells.
References
  • Dickinson DP, et al. (1993) Genomic cloning, physical mapping, and expression of human type 2 cystatin genes. Crit Rev Oral Biol. 4(3-4):573-80.
  • Dickinson DP, et al. (1995) Direct mapping of seven genes encoding human type 2 cystatins to a single site located at 20p11.2. Genomics. 24(1):172-5.
  • Thiesse M, et al. (1994) The human type 2 cystatin gene family consists of eight to nine members, with at least seven genes clustered at a single locus on human chromosome 20. DNA Cell Biol. 13(2): 97-116.
  • TOP