Human Testatin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC029656

RefSeq ORF Size

444bp

Gene Synonym

bA218C14.1, CST9L

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cystatin 9-like Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are strikingly restricted to reproductive tissue. Cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. There are typically about 115 amino acids in this family. They are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds, may be glycosylated and/or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Testatin shows homology to family 2 cystatins, a group of broadly expressed small secretory proteins that are inhibitors of cysteine proteases in vitro but whose in vivo functions are unclear. It is expressed in germ cells and somatic cells in reproductive tissues. Testatin is considered a strong candidate for involvement in early testis development. Testatin expression is maintained in the adult Sertoli cell, and it can also be found in a small population of germ cells.

References

Dickinson DP, et al. (1993) Genomic cloning, physical mapping, and expression of human type 2 cystatin genes. Crit Rev Oral Biol. 4(3-4):573-80.

Dickinson DP, et al. (1995) Direct mapping of seven genes encoding human type 2 cystatins to a single site located at 20p11.2. Genomics. 24(1):172-5.

Thiesse M, et al. (1994) The human type 2 cystatin gene family consists of eight to nine members, with at least seven genes clustered at a single locus on human chromosome 20. DNA Cell Biol. 13(2): 97-116.

Catalog Number:HGH660-CY