Human TAOK3/JIK Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_016281.3

RefSeq ORF Size

2697bp

Gene Synonym

DPK, JIK, MAP3K18, FLJ31808, DKFZp666H245, TAOK3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human TAO kinase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serine/threonine-protein kinase TAO3, also known as cutaneous T-cell lymphoma-associated antigen HD-CL-09, CTCL-associated antigen HD-CL-09, Dendritic cell-derived protein kinase, JNK / SAPK-inhibitory kinase, Jun kinase-inhibitory kinase, Kinase from chicken homolog A, Thousand and one amino acid protein 3, JIK, TAOK3 and MAP3K18, is cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. Protein kinases are pivotal regulators of cell signaling that modulate each other's functions and activities through site-specific phosphorylation events. TAOK3 / JIK contains one protein kinase domain. TAOK3 / JIK is ubiquitously expressed at a low level, and highly expressed in peripheral blood leukocytes (PBLs), thymus, spleen, kidney, skeletal muscle, heart and liver. TAOK3 / JIK inhibits the basal activity of Jun kinase. It is negatively regulated by epidermal growth factor (EGF). When overexpressed, TAOK3 / JIK may activate ERK1 / ERK2 and JNK / SAPK.

References

Tassi E., et al., 1999, J. Biol. Chem. 274:33287-95.

Yoneda T., et al., 2001, J. Biol. Chem. 276:13935-40.

Yustein J.T., et al.,2003, Oncogene 22:6129-41.

Daub H., et al., 2008, Mol. Cell 31:438-48.

Catalog Number:HGH598-NY