Human TAOK3/JIK Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGH598-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2697bp
Gene Synonym
DPK, JIK, MAP3K18, FLJ31808, DKFZp666H245, TAOK3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human TAO kinase 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine/threonine-protein kinase TAO3, also known as cutaneous T-cell lymphoma-associated antigen HD-CL-09, CTCL-associated antigen HD-CL-09, Dendritic cell-derived protein kinase, JNK / SAPK-inhibitory kinase, Jun kinase-inhibitory kinase, Kinase from chicken homolog A, Thousand and one amino acid protein 3, JIK, TAOK3 and MAP3K18, is cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. Protein kinases are pivotal regulators of cell signaling that modulate each other's functions and activities through site-specific phosphorylation events. TAOK3 / JIK contains one protein kinase domain. TAOK3 / JIK is ubiquitously expressed at a low level, and highly expressed in peripheral blood leukocytes (PBLs), thymus, spleen, kidney, skeletal muscle, heart and liver. TAOK3 / JIK inhibits the basal activity of Jun kinase. It is negatively regulated by epidermal growth factor (EGF). When overexpressed, TAOK3 / JIK may activate ERK1 / ERK2 and JNK / SAPK.
References
  • Tassi E., et al., 1999, J. Biol. Chem. 274:33287-95.
  • Yoneda T., et al., 2001, J. Biol. Chem. 276:13935-40.
  • Yustein J.T., et al.,2003, Oncogene 22:6129-41.
  • Daub H., et al., 2008, Mol. Cell 31:438-48.
  • TOP