Human SUB1 / PC4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGH506-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
384bp
Gene Synonym
MGC102747, P15, PC4, p14, SUB1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SUB1 homolog (S. cerevisiae) Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SUB1 belongs to the transcriptional coactivator PC4 family. It is a general coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. SUB1 binds single-stranded DNA. Single-stranded DNA-binding proteins play many roles in nucleic acid metabolism, but their importance during transcription remains unclear. SUB1 exhibits strong genetic interactions with factors necessary for promoter melting. It localizes near the transcription bubble in vitro and binds to promoters in vivo dependent upon preinitiation complexes assembly. SUB1 interacts with the nontemplate strand of RNApII complexes during initiation. It may also be involved in stabilizing the multiprotein transcription complex.
References
  • Knaus R, et al. (1996) Yeast SUB1 is a suppressor of TFIIB mutations and has homology to the human co-activator PC4. EMBO J. 15(8):1933-40.
  • Ge H, et al. (1994) Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell. 78(3):513-23.
  • Kaiser K, et al. (1994) A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators. Cell. 78(3):525-34.
  • TOP