Human SUB1 / PC4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC010537

RefSeq ORF Size

384bp

Gene Synonym

MGC102747, P15, PC4, p14, SUB1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human SUB1 homolog (S. cerevisiae) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SUB1 belongs to the transcriptional coactivator PC4 family. It is a general coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. SUB1 binds single-stranded DNA. Single-stranded DNA-binding proteins play many roles in nucleic acid metabolism, but their importance during transcription remains unclear. SUB1 exhibits strong genetic interactions with factors necessary for promoter melting. It localizes near the transcription bubble in vitro and binds to promoters in vivo dependent upon preinitiation complexes assembly. SUB1 interacts with the nontemplate strand of RNApII complexes during initiation. It may also be involved in stabilizing the multiprotein transcription complex.

References

Knaus R, et al. (1996) Yeast SUB1 is a suppressor of TFIIB mutations and has homology to the human co-activator PC4. EMBO J. 15(8):1933-40.

Ge H, et al. (1994) Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell. 78(3):513-23.

Kaiser K, et al. (1994) A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators. Cell. 78(3):525-34.

Catalog Number:HGH506-CF