Human STK40 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH477-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308bp
Gene Synonym
SHIK, SgK495, MGC4796, RP11-268J15.4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serine/threonine kinase 40 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
STK40 localized to both the cytoplasm and the nucleus. It is ubiquitously expressed. Mechanistically, Stk40 interacts with Rcn2, which also activates Erk1/2 to induce ExEn specification in mouse ESCs. Stk40 is able to activate the Erk/MAPK pathway and induce extraembryonic-endoderm (ExEn) differentiation in mouse ESCs. Interestingly, cells overexpressing Stk40 exclusively contribute to the ExEn layer of chimeric embryos when injected into host blastocysts. In contrast, deletion of Stk40 in ESCs markedly reduces ExEn differentiation in vitro. STK40 has a central serine/threonine protein kinase domain and is homologous to TRB-3, a protein that regulates activation of MAP kinases and inhibits NFκB-mediated gene transcription. Similarly, overexpression of STK40 inhibits NFκB activation triggered by TNF and also inhibits p53-mediated transcription. There are four named isoforms of STK40 that are produced as a result of alternative splicing.
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10(11): 1788-95.
  • TOP