Human STK40 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_032017.1

RefSeq ORF Size

1308bp

Gene Synonym

SHIK, SgK495, MGC4796, RP11-268J15.4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serine/threonine kinase 40 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

STK40 localized to both the cytoplasm and the nucleus. It is ubiquitously expressed. Mechanistically, Stk40 interacts with Rcn2, which also activates Erk1/2 to induce ExEn specification in mouse ESCs. Stk40 is able to activate the Erk/MAPK pathway and induce extraembryonic-endoderm (ExEn) differentiation in mouse ESCs. Interestingly, cells overexpressing Stk40 exclusively contribute to the ExEn layer of chimeric embryos when injected into host blastocysts. In contrast, deletion of Stk40 in ESCs markedly reduces ExEn differentiation in vitro. STK40 has a central serine/threonine protein kinase domain and is homologous to TRB-3, a protein that regulates activation of MAP kinases and inhibits NFκB-mediated gene transcription. Similarly, overexpression of STK40 inhibits NFκB activation triggered by TNF and also inhibits p53-mediated transcription. There are four named isoforms of STK40 that are produced as a result of alternative splicing.

References

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Wiemann S, et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res. 11(3):422-35.

Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10(11): 1788-95.

Catalog Number:HGH477-CO