Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGH469-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1701bp
Gene Synonym
MSSK1, STK23, MSSK-1, MGC102944, SRPK3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SRSF protein kinase 3 transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine / threonine-protein kinase SRPK3, also known as Muscle-specific serine kinase 1, Serine/arginine-rich protein-specific kinase 3, SR-protein-specific kinase 3, Serine / threonine-protein kinase 23, MSSK-1, SRPK3 and MSSK1, is a member of the protein kinase superfamily and CMGC Ser / Thr protein kinase family. SRPK3 is a protein kinase belonging to serine/arginine protein kinases (SRPK) family, which phosphorylates serine / arginine repeat-containing proteins, and is controlled by a muscle-specific enhancer directly regulated by MEF2. SRPK3 / MSSK1 contains one protein kinase domain. SRPK3 / MSSK1 is exclusively expressed in skeletal and heart muscle. It is required for normal muscle development. Myocyte enhancer factor 2 (MEF2) plays essential roles in transcriptional control of muscle development. Normal muscle growth and homeostasis require MEF2-dependent signaling by SRPK3.
References
  • Greenman C., et al., 2007, Nature 446:153-8.
  • Xu,Y. et al., 2011, Mol Biol Rep. 38 (5):2903-9.
  • TOP