Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGH469-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1701bp
Gene Synonym
MSSK1, STK23, MSSK-1, MGC102944, SRPK3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SRSF protein kinase 3 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine / threonine-protein kinase SRPK3, also known as Muscle-specific serine kinase 1, Serine/arginine-rich protein-specific kinase 3, SR-protein-specific kinase 3, Serine / threonine-protein kinase 23, MSSK-1, SRPK3 and MSSK1, is a member of the protein kinase superfamily and CMGC Ser / Thr protein kinase family. SRPK3 is a protein kinase belonging to serine/arginine protein kinases (SRPK) family, which phosphorylates serine / arginine repeat-containing proteins, and is controlled by a muscle-specific enhancer directly regulated by MEF2. SRPK3 / MSSK1 contains one protein kinase domain. SRPK3 / MSSK1 is exclusively expressed in skeletal and heart muscle. It is required for normal muscle development. Myocyte enhancer factor 2 (MEF2) plays essential roles in transcriptional control of muscle development. Normal muscle growth and homeostasis require MEF2-dependent signaling by SRPK3.
References
  • Greenman C., et al., 2007, Nature 446:153-8.
  • Xu,Y. et al., 2011, Mol Biol Rep. 38 (5):2903-9.
  • TOP