Human SRPK1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGH392-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1968bp
Gene Synonym
SFRSK1, SRPK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SFRS protein kinase 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine / threonine-protein kinase SRPK1, also known as SFRS protein kinase 1, Serine/arginine-rich protein-specific kinase 1, SR-protein-specific kinase 1 and SRPK1, is a cytoplasm and nucleus protein which belongs to the protein kinase superfamily and CMGC Ser/Thr protein kinase family. Isoform 2 of SRPK1 is predominantly expressed in the testis but is also present at lower levels in heart, ovary, small intestine, liver, kidney, pancreas and skeletal muscle. Isoform 1 of SRPK1 is only seen in the testis, at lower levels than isoform 2. SRPK1 hyperphosphorylates RS domain-containing proteins such as SFRS1, SFRS2 and ZRSR2 on serine residues during metaphase but at lower levels during interphase. SRPK1 plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. SRPK1 locks onto SFRS1 to form a stable complex and processively phosphorylates the RS domain. SRPK1 appears to mediate HBV core protein phosphorylation which is a prerequisite for pregenomic RNA encapsidation into viral capsids.
References
  • Ngo J.C.K. et al., 2005, Mol. Cell 20:77-89.
  • Krishnakumar,S. et al., 2008, Pediatr Blood Cancer 50 (2):402-6.
  • Ma,C.T. et al., 2009, J Mol Biol  390 (4):618-34.
  • Souki S.K. et al., 2009, J. Virol. 83:8970-8975.
  • Choudhary C. et al., 2009, Science 325:834-840. 
  • TOP