Human SRPK1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC038292

RefSeq ORF Size

1968bp

Gene Synonym

SFRSK1, SRPK1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human SFRS protein kinase 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serine / threonine-protein kinase SRPK1, also known as SFRS protein kinase 1, Serine/arginine-rich protein-specific kinase 1, SR-protein-specific kinase 1 and SRPK1, is a cytoplasm and nucleus protein which belongs to the protein kinase superfamily and CMGC Ser/Thr protein kinase family. Isoform 2 of SRPK1 is predominantly expressed in the testis but is also present at lower levels in heart, ovary, small intestine, liver, kidney, pancreas and skeletal muscle. Isoform 1 of SRPK1 is only seen in the testis, at lower levels than isoform 2. SRPK1 hyperphosphorylates RS domain-containing proteins such as SFRS1, SFRS2 and ZRSR2 on serine residues during metaphase but at lower levels during interphase. SRPK1 plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. SRPK1 locks onto SFRS1 to form a stable complex and processively phosphorylates the RS domain. SRPK1 appears to mediate HBV core protein phosphorylation which is a prerequisite for pregenomic RNA encapsidation into viral capsids.

References

Ngo J.C.K. et al., 2005, Mol. Cell 20:77-89.

Krishnakumar,S. et al., 2008, Pediatr Blood Cancer 50 (2):402-6.

Ma,C.T. et al., 2009, J Mol Biol 390 (4):618-34.

Souki S.K. et al., 2009, J. Virol. 83:8970-8975.

Choudhary C. et al., 2009, Science 325:834-840.

Catalog Number:HGH392-CY