Human SMOC-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGH239-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308bp
Gene Synonym
SMOC1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SPARC related modular calcium binding 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.
References
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • TOP