Human SMOC-1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGH239-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308bp
Gene Synonym
SMOC1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SPARC related modular calcium binding 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.
References
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • TOP